Pcdhga1^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdhga1^{em1(IMPC)Hmgu}
• Name: protocadherin gamma subfamily A, 1; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6273954
• Gene: Pcdhga1 Location: Chr18:37794846-37974926 bp, + strand Genetic Position: Chr18, 19.54 cM
• Alliance: Pcdhga1^{em1(IMPC)Hmgu} page
• IMPC: Pcdhga1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences ACCCGGGAGCTGATGGAGCG, GAGTGAGATCTCACGGGAAT, GTGCCAGAAGAAACCGACAA, and TGGTGCTCAAGCTGCGACAT that targeted exon(s) ENSMUSE00001338318.2 ENSMUSE00001340992.2 ENSMUSE00001343605.2 ENSMUSE00001343943.2 ENSMUSE00000432127.4 ENSMUSE00000476473.5 ENSMUSE00000507253.5 ENSMUSE00000847003.2 ENSMUSE00000888625.2 ENSMUSE00001105722.2 ENSMUSE00001336662.2 ENSMUSE00001337571.2 ENSMUSE00001338135.2 ENSMUSE00001338372.2 ENSMUSE00001338574.2 ENSMUSE00001339721.2 ENSMUSE00001339933.2 ENSMUSE00001342209.2 ENSMUSE00001342479.2 ENSMUSE00001343358.2 ENSMUSE00001343883.2 ENSMUSE00001343960.2 ENSMUSE00001346069.2 ENSMUSE00001465849.3 ENSMUSE00001497201.1 ENSMUSE00001497203.1 ENSMUSE00001653252.1 ENSMUSE00001653253.1 ENSMUSE00001653613.1 ENSMUSE00001653615.1. This resulted in deletion(s) of 2159 bp (location: Chr18:37795107-37797265; GRCm39), 85153 bp (location: Chr18:37797384-37882536; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pcdhga1 Mutation: 79 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)