Abhd4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abhd4^em1(IMPC)J
• Name: abhydrolase domain containing 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6273658
• Gene: Abhd4 Location: Chr14:54491586-54506626 bp, + strand Genetic Position: Chr14, 27.71 cM
• Alliance: Abhd4^em1(IMPC)J page
• IMPC: Abhd4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAAAATGTCTGTGCTCTC and TGATCGCTAGGGAAGCCATG, which resulted in a 3008 bp deletion beginning at Chromosome 14 position 54,262,600 bp and ending after 54,265,607 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324218, ENSMUSE00001373598, ENSMUSE00000324196 (exons 3-5) and 2368 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 8 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Abhd4 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)