Ascl4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ascl4^em1(IMPC)J
• Name: achaete-scute family bHLH transcription factor 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6273154
• Gene: Ascl4 Location: Chr10:85763266-85765513 bp, + strand Genetic Position: Chr10, 41.8 cM
• Alliance: Ascl4^em1(IMPC)J page
• IMPC: Ascl4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCTGAGTGGGATTAGAAG and CATTCAGCTCAAATGCCAAA, which resulted in a 2177 bp deletion beginning at Chromosome 10 position 85,927,535 bp and ending after 85,929,711 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000912627 (exon 1) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ascl4 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)