About   Help   FAQ
Iqchem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Iqchem1(IMPC)J
Name: IQ motif containing H; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6272676
Gene: Iqch  Location: Chr9:63328737-63509775 bp, - strand  Genetic Position: Chr9, 34.08 cM, cytoband D
Alliance: Iqchem1(IMPC)J page
IMPC: Iqch gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAACGCCGTTTCGAGCGA and GTAATTGATGAAGTGTTAGT, which resulted in a 1108 bp deletion beginning at Chromosome 9 position 63,524,247 bp and ending after 63,525,354 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324999 (exon 10) and 456 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 288, remove 188 amino acids, and return into frame for the stop codon. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Iqch Mutation:  53 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory