About   Help   FAQ
Slc27a6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc27a6em1(IMPC)J
Name: solute carrier family 27 (fatty acid transporter), member 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6272674
Gene: Slc27a6  Location: Chr18:58689329-58745845 bp, + strand  Genetic Position: Chr18, 33.71 cM
Alliance: Slc27a6em1(IMPC)J page
IMPC: Slc27a6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTTTGTAACCAGTGACCG and ATACGCTTTGTCCTGCAGCA, which resulted in a 424 bp deletion beginning at Chromosome 18 position 58,582,070 bp and ending after 58,582,493 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000362415(exon 4) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 281 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc27a6 Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory