Ccdc117^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc117^em1(IMPC)J
• Name: coiled-coil domain containing 117; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6269391
• Gene: Ccdc117 Location: Chr11:5478887-5492187 bp, - strand Genetic Position: Chr11, 3.61 cM
• Alliance: Ccdc117^em1(IMPC)J page
• IMPC: Ccdc117 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGTTCTCTTAAAGCTGGG and GTCTTACATTTCGTCTATAA, which resulted in an 886 bp deletion beginning at Chromosome 11 position 5,534,174 bp and ending after 5,535,059 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000266605 and ENSMUSE00000105246 (exons 3 and 4) and 523 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to delete 121 amino acids after residue 72 and then remain in phase for the last 78 amino acids. This removes more than 45 percent of the encoded protein. (J:188991, J:384794)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc117 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)