About   Help   FAQ
Ccdc117em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc117em1(IMPC)J
Name: coiled-coil domain containing 117; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6269391
Gene: Ccdc117  Location: Chr11:5478887-5492187 bp, - strand  Genetic Position: Chr11, 3.61 cM
Alliance: Ccdc117em1(IMPC)J page
IMPC: Ccdc117 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGTTCTCTTAAAGCTGGG and GTCTTACATTTCGTCTATAA, which resulted in an 886 bp deletion beginning at Chromosome 11 position 5,534,174 bp and ending after 5,535,059 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000266605 and ENSMUSE00000105246 (exons 3 and 4) and 523 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to delete 121 amino acids after residue 72 and then remain in phase for the last 78 amino acids. This removes more than 45 percent of the encoded protein. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc117 Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory