Fam124b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam124b^em1(IMPC)J
• Name: family with sequence similarity 124, member B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6267298
• Gene: Fam124b Location: Chr1:80176416-80192050 bp, - strand Genetic Position: Chr1, 41.19 cM
• Alliance: Fam124b^em1(IMPC)J page
• IMPC: Fam124b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGAGTTGGTTCAGTGGA and GCTGTAGTTTGGCACAGCAG, which resulted in a 2019 bp deletion beginning at Chromosome 1 position 80,198,618 bp and ending after 80,200,636 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409540 (exon 2) and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 244 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam124b Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)