About   Help   FAQ
Fam124bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam124bem1(IMPC)J
Name: family with sequence similarity 124, member B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6267298
Gene: Fam124b  Location: Chr1:80176416-80192050 bp, - strand  Genetic Position: Chr1, 41.19 cM
Alliance: Fam124bem1(IMPC)J page
IMPC: Fam124b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGAGTTGGTTCAGTGGA and GCTGTAGTTTGGCACAGCAG, which resulted in a 2019 bp deletion beginning at Chromosome 1 position 80,198,618 bp and ending after 80,200,636 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409540 (exon 2) and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 244 and early truncation 27 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fam124b Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory