Pcdha2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pcdha2em1(IMPC)Tcp |
| Name: |
protocadherin alpha 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:6266829 |
| Gene: |
Pcdha2 Location: Chr18:37072258-37320710 bp, + strand Genetic Position: Chr18, 19.46 cM
|
| Alliance: |
Pcdha2em1(IMPC)Tcp page
|
| IMPC: |
Pcdha2 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CTGTCATTGGAAATCGCGGC and TGCGGAGGTGAAATTGTTAC that targeted exon(s) ENSMUSE00000703754.3 ENSMUSE00001339128.2 ENSMUSE00001336252.2 ENSMUSE00000392798.4 ENSMUSE00000659592.4 ENSMUSE00000901347.2 ENSMUSE00001337620.2 ENSMUSE00001339159.2 ENSMUSE00001339343.2 ENSMUSE00001971692.1 ENSMUSE00000625561.4 ENSMUSE00000703749.2 ENSMUSE00001337426.2 ENSMUSE00001342804.2 ENSMUSE00000703752.3 ENSMUSE00001338367.2 ENSMUSE00001339236.2 ENSMUSE00001339302.2 ENSMUSE00001339682.2 ENSMUSE00001340498.2 ENSMUSE00001341408.2 ENSMUSE00001342083.2 ENSMUSE00001342105.2 ENSMUSE00001344937.2 ENSMUSE00001345403.2 ENSMUSE00002174561.1. This resulted in deletion(s) of 6 bp (location: Chr18:37072997-37073002; GRCm39), 13 bp (location: Chr18:37113742-37113754; GRCm39), 14 bp (location: Chr18:37113721-37113734; GRCm39), 97 bp (location: Chr18:37072666-37072762; GRCm39), 162 bp (location: Chr18:37079549-37079710; GRCm39), 6004 bp (location: Chr18:37073285-37079288; GRCm39), 9548 bp (location: Chr18:37144209-37153756; GRCm39), 30194 bp (location: Chr18:37113775-37143968; GRCm39), and 33963 bp (location: Chr18:37079736-37113698; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|