About   Help   FAQ
Tspyl4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tspyl4em1(IMPC)J
Name: TSPY-like 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6260179
Gene: Tspyl4  Location: Chr10:34173438-34177316 bp, + strand  Genetic Position: Chr10, 18.85 cM, cytoband B1
Alliance: Tspyl4em1(IMPC)J page
IMPC: Tspyl4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGCCAGTTCTCGCGCTA and GTCTGGGTGAATGTACAGTT, which resulted in a 3982 bp deletion beginning at Chromosome 10 position 34,297,362 bp and ending after 34,301,343 bp (GRCm38/mm10) with a single base pair insertion (C) at the deletion site. This mutation deletes ENSMUSE00000316800 (exon 1) and 103 bp of flanking intronic sequence including the entire coding sequence and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tspyl4 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory