Zbtb44^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbtb44^em1(IMPC)J
• Name: zinc finger and BTB domain containing 44; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6260061
• Gene: Zbtb44 Location: Chr9:30941940-30987181 bp, + strand Genetic Position: Chr9, 16.56 cM
• Alliance: Zbtb44^em1(IMPC)J page
• IMPC: Zbtb44 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATCTAAAAAGCAGCCT and CCCCCATACAACAACCCTGA, which resulted in a 404 bp deletion beginning at Chromosome 9 position 31,063,974 bp and ending after 31,064,377 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000413910 (exon 4) and 388 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 368 and early truncation 1 amino acid later. In addition, there is a 23 bp insertion (ACTGTAGGAACTGATGAGAGTTG) at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zbtb44 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)