Tmem164em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmem164em1(IMPC)J |
| Name: |
transmembrane protein 164; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6260040 |
| Gene: |
Tmem164 Location: ChrX:141464402-141626490 bp, + strand Genetic Position: ChrX, 63.54 cM
|
| Alliance: |
Tmem164em1(IMPC)J page
|
| IMPC: |
Tmem164 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTGCGAGAAGTGACCCT and TTACACTTCAGCTACAGCAA, which resulted in a 340 bp deletion beginning at Chromosome X position 142,770,892 bp and ending after 142,771,231 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001301823 (exon 4) and 273 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 5 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|