Tex36^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tex36^em1(IMPC)J
• Name: testis expressed 36; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259893
• Gene: Tex36 Location: Chr7:133188753-133203844 bp, - strand Genetic Position: Chr7, 77.09 cM, cytoband F4
• Alliance: Tex36^em1(IMPC)J page
• IMPC: Tex36 gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCTTTTCACCTGTCAAGA and GGACAATGCTGAATCCATGA, which resulted in a 571 bp deletion beginning at Chromosome 7 position 133,601,825 bp and ending after 133,602,395 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000205104 (exon 1) and 380 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tex36 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)