Pold4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pold4^em1(IMPC)J
• Name: polymerase (DNA-directed), delta 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259891
• Gene: Pold4 Location: Chr19:4281953-4283688 bp, + strand Genetic Position: Chr19, 3.93 cM
• Alliance: Pold4^em1(IMPC)J page
• IMPC: Pold4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGATGGCAAAGGCAAAT and CCCTACGTAGACCAAGAGGG, which resulted in a 2-part deletion beginning at Chromosome 19 position 4,232,361 bp for 446 bp, followed by 5 bp of retained sequence (TGGGT), then an additional 110 bp deletion that ends after 4,232,921 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145535 and ENSMUSE00000145533 (exons 2 and 3) and 355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pold4 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)