Ezh2^em1Jbn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ezh2^em1Jbn
• Name: enhancer of zeste 2 polycomb repressive complex 2 subunit; endonuclease-mediated mutation 1, Jeffrey Baron
• MGI ID: MGI:6259828
• Synonyms: Ezh2(V626M)
• Gene: Ezh2 Location: Chr6:47507073-47572275 bp, - strand Genetic Position: Chr6, 22.92 cM, cytoband B
• Alliance: Ezh2^em1Jbn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutations: Insertion, Single point mutation
• Mutation details: CRISPR/Cas9 technology using guide RNA (CCCCAGCCTGCCACATCAGACGG), SpCas9, and a 127 bp ssODN template introduce a c.1876 G-to-A transversion (NM_004456.4). The resultant GTG to ATG bp (p.V626M) substitution in exon 16 of the gene is confirmed through sequencing. (J:267184)

Disease models

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ezh2 Mutation: 71 strains or lines available

References

• Original: J:267184 Lui JC, et al., Ezh2 Mutations Found in the Weaver Overgrowth Syndrome Cause a Partial Loss of H3K27 Histone Methyltransferase Activity. J Clin Endocrinol Metab. 2018 Apr 1;103(4):1470-1478
• All: 1 reference(s)