Spc25em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Spc25em1(IMPC)J |
| Name: |
SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae); endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6259583 |
| Gene: |
Spc25 Location: Chr2:69024239-69036538 bp, - strand Genetic Position: Chr2, 39.64 cM, cytoband C3
|
| Alliance: |
Spc25em1(IMPC)J page
|
| IMPC: |
Spc25 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATTACACTCTCAGCCTTTAG, AGGTTGACTTTGCTACAGAA, GGGCCCCAAATACATCTATG and CAGACATAAACTCGAAAATG, which resulted in an 8330 bp deletion beginning at Chromosome 2 position 69,196,943 bp and ending after 69,205,272 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291289-ENSMUSE00000165579 (exons 2-6) and 7760 bp of flanking intronic sequence including the start site and splice acceptors and donors and is predicted to result in a null allele. In addition, there is a 57 bp insertion at the deletion site (Chr2:69,196,929-69,196,985).
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|