About   Help   FAQ
Haus4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Haus4em1(IMPC)J
Name: HAUS augmin-like complex, subunit 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6259158
Synonyms: Haus4-
Gene: Haus4  Location: Chr14:54779242-54792073 bp, - strand  Genetic Position: Chr14, 27.83 cM
Alliance: Haus4em1(IMPC)J page
IMPC: Haus4 gene page
Haus4em1(IMPC)J/Haus4em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 that appear as morulae, but no embryos at E7.5. Mutants hatch from the zona and form irregular outgrowths with trophectoderm and primitive endoderm cells but small/no inner cell mass colony.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGGGCACATGAGCAGGCCG and GCACACAGACTGTTAGCACG, which resulted in a 137 bp deletion beginning at Chromosome 14 position 54,545,708 bp and ending after 54,545,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124158 (exon 6) and 40 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Haus4 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory