About   Help   FAQ
Ttc38em1Llp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttc38em1Llp
Name: tetratricopeptide repeat domain 38; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6259151
Gene: Ttc38  Location: Chr15:85716545-85743023 bp, + strand  Genetic Position: Chr15, 40.42 cM
Alliance: Ttc38em1Llp page
IMPC: Ttc38 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 2 guide sequences, GCTCTCATTTCATGTACGT, GCAATCGGAAGGTCACTGGA, which resulted in a 62 bp deletion beginning at approximately Chromosome 15 position 85,844,505 bp, ACATGAAA, and ending after 85,844,566 bp, GGTCACT (GRCm38.p6/mm10). This mutation deletes much of ENSMUSE00001278296 (exon 7). (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ttc38 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory