Cr2em1Llp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cr2em1Llp |
| Name: |
complement receptor 2; endonuclease-mediated mutation 1, Luanne Peters |
| MGI ID: |
MGI:6259110 |
| Gene: |
Cr2 Location: Chr1:194819119-194859024 bp, - strand Genetic Position: Chr1, 98.44 cM
|
| Alliance: |
Cr2em1Llp page
|
| IMPC: |
Cr2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 4 guide sequences, GTTGACCAGTTTGTTGCG, GTACTTCTCCTGTAATGAA, GCACACATGGGATCCTT, and GTTCTTGGTGAGCTGGGCAC, which resulted in a 60 bp deletion beginning at approximately Chromosome 1 position 195176543 bp, CTTGGG, and ending after 195176602 bp, GCTGGG (GRCm38.p4/mm10). This mutation deletes most of exon 1 and some of the downstream intron.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|