About   Help   FAQ
Cr2em1Llp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cr2em1Llp
Name: complement receptor 2; endonuclease-mediated mutation 1, Luanne Peters
MGI ID: MGI:6259110
Gene: Cr2  Location: Chr1:194819119-194859024 bp, - strand  Genetic Position: Chr1, 98.44 cM
Alliance: Cr2em1Llp page
IMPC: Cr2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 4 guide sequences, GTTGACCAGTTTGTTGCG, GTACTTCTCCTGTAATGAA, GCACACATGGGATCCTT, and GTTCTTGGTGAGCTGGGCAC, which resulted in a 60 bp deletion beginning at approximately Chromosome 1 position 195176543 bp, CTTGGG, and ending after 195176602 bp, GCTGGG (GRCm38.p4/mm10). This mutation deletes most of exon 1 and some of the downstream intron. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cr2 Mutation:  84 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory