About   Help   FAQ
Klhl40em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Klhl40em1(IMPC)J
Name: kelch-like 40; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258650
Gene: Klhl40  Location: Chr9:121606673-121612884 bp, + strand  Genetic Position: Chr9, 72.61 cM, cytoband F4
Alliance: Klhl40em1(IMPC)J page
IMPC: Klhl40 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GGACCACAGCAGCAACCAGG and GGTTAGGCAGATAAAAAGGG that targeted exon(s) ENSMUSE00000633486.2. This resulted in deletion(s) of 471 bp (location: Chr9:121608767-121609237; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Klhl40 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory