About   Help   FAQ
Iffo2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Iffo2em1(IMPC)J
Name: intermediate filament family orphan 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258578
Gene: Iffo2  Location: Chr4:139257859-139347693 bp, + strand  Genetic Position: Chr4, 70.73 cM
Alliance: Iffo2em1(IMPC)J page
IMPC: Iffo2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailselectroporating Cas9 protein and 2 guide sequences GGGAGGGAACCACTGTCCCG and CTAGCTGAGGATATGTCCCC, which resulted in a 250 bp deletion beginning at Chromosome 4 position 139,607,520 bp and ending after 139,607,769 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001229038 (exon 5) and 110 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 316 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Iffo2 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory