About   Help   FAQ
Nfycem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nfycem1(IMPC)J
Name: nuclear transcription factor-Y gamma; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258566
Gene: Nfyc  Location: Chr4:120614635-120688769 bp, - strand  Genetic Position: Chr4, 56.52 cM
Alliance: Nfycem1(IMPC)J page
IMPC: Nfyc gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGATCAGTAGAAACAAGACT and AATTGTTTCATTCAGTGTTA, which resulted in a 292 bp deletion beginning at Chromosome 4 position 120,790,326 bp and ending after 120,790,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000412384 (exon 2) and 179 bp of flanking intronic sequence including the start and splice donor and is predicted to cause a null allele unless a downstream ATG is used. In addition, there is a 7 bp insertion [TATCAGT] at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nfyc Mutation:  180 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory