Nfycem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Nfycem1(IMPC)J |
Name: |
nuclear transcription factor-Y gamma; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6258566 |
Gene: |
Nfyc Location: Chr4:120614635-120688769 bp, - strand Genetic Position: Chr4, 56.52 cM
|
Alliance: |
Nfycem1(IMPC)J page
|
IMPC: |
Nfyc gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGATCAGTAGAAACAAGACT and AATTGTTTCATTCAGTGTTA, which resulted in a 292 bp deletion beginning at Chromosome 4 position 120,790,326 bp and ending after 120,790,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000412384 (exon 2) and 179 bp of flanking intronic sequence including the start and splice donor and is predicted to cause a null allele unless a downstream ATG is used. In addition, there is a 7 bp insertion [TATCAGT] at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|