Nfyc^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nfyc^em1(IMPC)J
• Name: nuclear transcription factor-Y gamma; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258566
• Gene: Nfyc Location: Chr4:120614635-120688769 bp, - strand Genetic Position: Chr4, 56.52 cM
• Alliance: Nfyc^em1(IMPC)J page
• IMPC: Nfyc gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGATCAGTAGAAACAAGACT and AATTGTTTCATTCAGTGTTA, which resulted in a 292 bp deletion beginning at Chromosome 4 position 120,790,326 bp and ending after 120,790,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000412384 (exon 2) and 179 bp of flanking intronic sequence including the start and splice donor and is predicted to cause a null allele unless a downstream ATG is used. In addition, there is a 7 bp insertion [TATCAGT] at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nfyc Mutation: 180 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)