Plekhj1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Plekhj1em1(IMPC)J |
| Name: |
pleckstrin homology domain containing, family J member 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6258452 |
| Gene: |
Plekhj1 Location: Chr10:80631933-80634404 bp, - strand Genetic Position: Chr10, 39.72 cM, cytoband C1
|
| Alliance: |
Plekhj1em1(IMPC)J page
|
| IMPC: |
Plekhj1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCACTCCCCAAAACCCA and AATCCTGGTGAGAGGAAGCT, which resulted in a 1061 bp deletion beginning at Chromosome 10 position 80,795,850 bp and ending after 80,796,910 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000306173, ENSMUSE00000306166 and ENSMUSE00001413139 (exons 4-6) and 469 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 48 amino acids later probably by read through after exon 3.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|