About   Help   FAQ
Kansl3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kansl3em1(IMPC)J
Name: KAT8 regulatory NSL complex subunit 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258443
Synonyms: Kansl3-
Gene: Kansl3  Location: Chr1:36374811-36408262 bp, - strand  Genetic Position: Chr1, 15.22 cM
Alliance: Kansl3em1(IMPC)J page
IMPC: Kansl3 gene page
Kansl3em1(IMPC)J/Kansl3em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida and are dead after 72 hours in vitro, never forming outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTGTGGTGGAAGAGACG and CCGCAAGTCACAACAAATCA, which resulted in an 898 bp deletion beginning at Chromosome 1 position 36,357,760 bp and ending after 36,358,657 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000156007, ENSMUSE00000155996 (exons 4 and 5) and 621 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 129 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 10 assay results
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kansl3 Mutation:  41 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory