Zbtb41em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zbtb41em1(IMPC)J |
| Name: |
zinc finger and BTB domain containing 41; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6258441 |
| Gene: |
Zbtb41 Location: Chr1:139350026-139380743 bp, + strand Genetic Position: Chr1, 61.36 cM
|
| Alliance: |
Zbtb41em1(IMPC)J page
|
| IMPC: |
Zbtb41 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATATATACCCAAATTCACAT, ATACTTGTTGCACTGCCAAA, ATACTTTCCCTCAAATGCTT and ACTTGTGTGACGCCAGGAGC, which resulted in a 431 bp deletion beginning at Chromosome 1 position 139,429,008 bp and ending after 139,429,438 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000659173 (exon 3) and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 372 and early truncation 39 amino acids later. In addition, there is an 8 bp insertion (CTAAAAAA) at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|