Prr5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prr5^em1(IMPC)J
• Name: proline rich 5 (renal); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258434
• Gene: Prr5 Location: Chr15:84553821-84587874 bp, + strand Genetic Position: Chr15, 39.95 cM, cytoband E
• Alliance: Prr5^em1(IMPC)J page
• IMPC: Prr5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCCTCACCAGTACTGT and AGCCCTCCTGGGCTCCCAAG, which resulted in a 481 bp deletion beginning at Chromosome 15 position 84,693,421 bp and ending after 84,693,901 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000622449 and ENSMUSE00000622448 (exons 3 and 4) and 374 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 16 amino acids later. There is also a single bp (A) insertion at the deletion site. (J:188991, J:384794)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prr5 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)