Shisa9^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shisa9^em1(IMPC)H
• Name: shisa family member 9; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6257819
• Gene: Shisa9 Location: Chr16:11801977-12088766 bp, + strand Genetic Position: Chr16, 6.89 cM, cytoband B1
• Alliance: Shisa9^em1(IMPC)H page
• IMPC: Shisa9 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CTACCCAATGGGTCTGCGGA, GATTGGGTTGTGTTTGCTAC, GCTACTGGTTATTCTTGACT, and TCCGCAGACCCATTGGGTAG that targeted exon(s) ENSMUSE00000897490.2. This resulted in deletion(s) of 6 bp (location: Chr16:11814678-11814683; GRCm39), 716 bp (location: Chr16:11814692-11815407; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Shisa9 Mutation: 26 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)