A2ml1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: A2ml1^em1(IMPC)Tcp
• Name: alpha-2-macroglobulin like 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257801
• Gene: A2ml1 Location: Chr6:128516784-128558571 bp, - strand Genetic Position: Chr6, 63.05 cM
• Alliance: A2ml1^em1(IMPC)Tcp page
• IMPC: A2ml1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1119 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATATACGAAGGCTTGAAACC targeting the 5' side and CGGACTACGGGCTTACTCCG targeting the 3' side of a critical exon. This resulted in a 220-bp deletion from Chr6: 128571947 to 128572166 resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (GRCm38) (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any A2ml1 Mutation: 88 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)