Spns3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spns3^em1(IMPC)Tcp
• Name: SPNS lysolipid transporter 3, sphingosine-1-phosphate (putative); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257798
• Gene: Spns3 Location: Chr11:72388979-72441334 bp, - strand Genetic Position: Chr11, 44.34 cM, cytoband B4
• Alliance: Spns3^em1(IMPC)Tcp page
• IMPC: Spns3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0997 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCCCAGAGTATACGGCACT and ATTGCCAAGGTGCCAGCTTG targeting the 5' side and ACAAGGATGTAGACCCTACC and ATCTAATAGCCTCCCTACTC targeting the 3' side of a critical region. This resulted in a 492-bp del ch11:72540262 to 72540753_insA (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spns3 Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)