Tcf20^{em2(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tcf20^{em2(IMPC)Wtsi}
• Name: transcription factor 20; endonuclease-mediated mutation 2, Wellcome Trust Sanger Institute
• MGI ID: MGI:6257777
• Gene: Tcf20 Location: Chr15:82692637-82872073 bp, - strand Genetic Position: Chr15, 38.73 cM, cytoband E
• Alliance: Tcf20^{em2(IMPC)Wtsi} page
• IMPC: Tcf20 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences AGCAGTCAGATCTGACTTAT, ATAATCTGATTAGATATAGT, CGATTTTGAGGAACTAGCTT, and TAGGGATTTAGCCTGATTAG that targeted exon(s) ENSMUSE00000474361.3 ENSMUSE00001546506.1 ENSMUSE00001546507.1. This resulted in deletion(s) of 37 bp (location: Chr15:82733929-82733965; GRCm39), 7800 bp (location: Chr15:82734315-82742114; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tcf20 Mutation: 92 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)