About   Help   FAQ
Otofem1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Otofem1(IMPC)Wtsi
Name: otoferlin; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6257766
Gene: Otof  Location: Chr5:30524406-30619276 bp, - strand  Genetic Position: Chr5, 16.48 cM, cytoband B1
Alliance: Otofem1(IMPC)Wtsi page
IMPC: Otof gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and the guide sequence CCTCTATTTCTGAAGGCCCCGTG, which resulted in a Point Mutation allele. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Otof Mutation:  110 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory