Psma8^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Psma8^em1(IMPC)Tcp
• Name: proteasome subunit alpha 8; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6257761
• Gene: Psma8 Location: Chr18:14839208-14895358 bp, + strand Genetic Position: Chr18, 8.25 cM, cytoband A2
• Alliance: Psma8^em1(IMPC)Tcp page
• IMPC: Psma8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1204 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATACAACTACGTTAGGGTGA and TGCACATCTTATCTCCTAGA targeting the 5' side and TTAGCCCTCACCTATGTTTA and AGGCCACAGCTCTATAAACT targeting the 3' side of a critical exon. This resulted in a 5-bp deletion at Chr18:14720902 to 14720906_CCCTA in the intron and a 382-bp del Chr18:14721054 to 14721435 which deleted exon ENSMUSE00000281907. This is predicted to result in p.(G36X) (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Psma8 Mutation: 21 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)