Efl1^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Efl1^em1(IMPC)Bay
• Name: elongation factor like GTPase 1; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257755
• Synonyms: Efl1^-
• Gene: Efl1 Location: Chr7:82297822-82427060 bp, + strand Genetic Position: Chr7, 47.25 cM
• Alliance: Efl1^em1(IMPC)Bay page
• IMPC: Efl1 gene page

Efl1^em1(IMPC)Bay/Efl1^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos show severe developmental delay, poorly organized extraembryonic tissues, and no gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CACTAAAGAGTTACAGCGAT, GAAGTAAAAACTGTTCAAAG, GAGAATGTTGAATTTGAGAG, and TGTGCTATCACCAGCCTTCC that targeted exon(s) ENSMUSE00001212434.2. This resulted in deletion(s) of 2 bp (location: Chr7:82321202-82321203; GRCm39), 971 bp (location: Chr7:82320222-82321192; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Efl1 Mutation: 55 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)