Ajubaem2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ajubaem2(IMPC)H |
| Name: |
ajuba LIM protein; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:6257751 |
| Gene: |
Ajuba Location: Chr14:54804929-54815015 bp, - strand Genetic Position: Chr14, 27.84 cM, cytoband C1
|
| Alliance: |
Ajubaem2(IMPC)H page
|
| IMPC: |
Ajuba gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCATCCTATTCTCACGCGTCTGT, CCAGCTGTTTCCGACCAGTAGCA, GGAGCCGATTCACGTAGCTCAGG, CCTATTCTCACGCGTCTGTCTAG, which resulted in a Exon Deletion.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ajuba Mutation: |
64 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
1 reference(s) |
|