Ajubaem2(IMPC)H
Endonuclease-mediated Allele Detail
|
Symbol: |
Ajubaem2(IMPC)H |
Name: |
ajuba LIM protein; endonuclease-mediated mutation 2, Harwell |
MGI ID: |
MGI:6257751 |
Gene: |
Ajuba Location: Chr14:54804929-54815015 bp, - strand Genetic Position: Chr14, 27.84 cM, cytoband C1
|
Alliance: |
Ajubaem2(IMPC)H page
|
IMPC: |
Ajuba gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCATCCTATTCTCACGCGTCTGT, CCAGCTGTTTCCGACCAGTAGCA, GGAGCCGATTCACGTAGCTCAGG, CCTATTCTCACGCGTCTGTCTAG, which resulted in a Exon Deletion.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Ajuba Mutation: |
62 strains or lines available
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
1 reference(s) |
|