About   Help   FAQ
Zfp804aem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp804aem1(IMPC)Tcp
Name: zinc finger protein 804A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6257708
Gene: Zfp804a  Location: Chr2:81883566-82090223 bp, + strand  Genetic Position: Chr2, 49.06 cM
Alliance: Zfp804aem1(IMPC)Tcp page
IMPC: Zfp804a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0985 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CACTATTGCCAAAGCTCTGG targeting the 5' side and ATATGACCACGCCCACAAAC targeting the 3' side of a critical region. This resulted in a 102 bp-del Chr2:82235835 to 82235936; in-frame intra-exon deletion deleting amino acids 50-85. The Pfam zinc finger double-stranded RNA binding domain is annotated from amino acid 57-84 amino acids in Ensembl build 38, so this domain is completely removed by this deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp804a Mutation:  53 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory