Ugt2a1^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ugt2a1^em1(IMPC)Bay
• Name: UDP glucuronosyltransferase 2 family, polypeptide A1; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257701
• Gene: Ugt2a1 Location: Chr5:87607349-87638730 bp, - strand Genetic Position: Chr5, 43.56 cM, cytoband E2
• Alliance: Ugt2a1^em1(IMPC)Bay page
• IMPC: Ugt2a1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AATGATGGAATACGATTTAC, CATACAGTCTTAATGTGATC, GTTCCTAGCAAGAGACTGGA, and TATCGTTCTAAAGAAAGTAT that targeted exon(s) ENSMUSE00001235580.2 ENSMUSE00001359327.2 ENSMUSE00001359374.2 ENSMUSE00001360439.2 ENSMUSE00001361498.2 ENSMUSE00001362769.2. This resulted in deletion(s) of 2201 bp (location: Chr5:87611535-87613735; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ugt2a1 Mutation: 18 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)