Il33em2(IMPC)Bay
Endonuclease-mediated Allele Detail
|
Symbol: |
Il33em2(IMPC)Bay |
Name: |
interleukin 33; endonuclease-mediated mutation 2, Baylor College of Medicine |
MGI ID: |
MGI:6257686 |
Gene: |
Il33 Location: Chr19:29902514-29938118 bp, + strand Genetic Position: Chr19, 24.56 cM, cytoband C2
|
Alliance: |
Il33em2(IMPC)Bay page
|
IMPC: |
Il33 gene page |
|
Strain of Origin: |
C57BL/6N
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA, 2 guide sequences CGTCCTCACCCCAACTGTGCAGG, TGGTCTTGTTGCTACAAGTCTGG, and a non-contributing oligo, which resulted in a Exon Deletion.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Il33 Mutation: |
30 strains or lines available
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
2 reference(s) |
|