Csrp1em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Csrp1em1(IMPC)Bay |
| Name: |
cysteine and glycine-rich protein 1; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6257685 |
| Gene: |
Csrp1 Location: Chr1:135647799-135679970 bp, + strand Genetic Position: Chr1, 59.23 cM
|
| Alliance: |
Csrp1em1(IMPC)Bay page
|
| IMPC: |
Csrp1 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences ACCAGGGTACAGAGGTTTGA, GGAGACTAAGTGCAGGTCTC, GGGCCAGGTCACTCAATCTC, and GGGGCGCACTGAGACTTGGA that targeted exon(s) ENSMUSE00000340932.5 ENSMUSE00000375897.5. This resulted in deletion(s) of 1885 bp (location: Chr1:135672838-135674722; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|