About   Help   FAQ
Zfp300em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp300em1(IMPC)Bay
Name: zinc finger protein 300; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6257683
Gene: Zfp300  Location: ChrX:20945413-20955766 bp, - strand  Genetic Position: ChrX, 16.59 cM
Alliance: Zfp300em1(IMPC)Bay page
IMPC: Zfp300 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences CCCTAGCTACAGCACAATTTCCC, AACTCCTTCTTCGGGACTAGGGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp300 Mutation:  7 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory