Atp5f1d^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp5f1d^em1(IMPC)Bay
• Name: ATP synthase F1 subunit delta; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257672
• Synonyms: Atp5f1d^-
• Gene: Atp5f1d Location: Chr10:79974466-79981652 bp, + strand Genetic Position: Chr10, 39.72 cM, cytoband C1
• Alliance: Atp5f1d^em1(IMPC)Bay page
• IMPC: Atp5f1d gene page

Atp5f1d^em1(IMPC)Bay/Atp5f1d^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CAGCGTGCTGATCCAGCCCC, CCAAGGCTATCTTACCCTAA, CCTCATAGCAACTTCCTGAG, and GGGTAAGATAGCCTTGGTGT that targeted exon(s) ENSMUSE00000100963.4. This resulted in deletion(s) of 12 bp (location: Chr10:79979395-79979406; GRCm39), 581 bp (location: Chr10:79979451-79980031; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Atp5f1d Mutation: 5 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)