About   Help   FAQ
Larp6em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Larp6em1(IMPC)Tcp
Name: La ribonucleoprotein 6, translational regulator; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6257663
Gene: Larp6  Location: Chr9:60620404-60646084 bp, + strand  Genetic Position: Chr9, 32.87 cM
Alliance: Larp6em1(IMPC)Tcp page
IMPC: Larp6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1076 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGTCCTCCAGTCCCGGGTG, GTTGAACGAGGACCACCGGA and CGAGTCCCCTGCTGTCTCGG. This resulted in a 869-bp del Chr9:60737072 to 60737940_insT (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Larp6 Mutation:  20 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory