Orai3^em2(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Orai3^em2(IMPC)Bay
• Name: ORAI calcium release-activated calcium modulator 3; endonuclease-mediated mutation 2, Baylor College of Medicine
• MGI ID: MGI:6257613
• Gene: Orai3 Location: Chr7:127368987-127374322 bp, + strand Genetic Position: Chr7, 69.73 cM
• Alliance: Orai3^em2(IMPC)Bay page
• IMPC: Orai3 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AAAGGTGTATGCCGCTGATT and GGAAATTGGTACCCTTCGAT that targeted exon(s) ENSMUSE00000715504.2 ENSMUSE00001221614.2 ENSMUSE00001285337.2 ENSMUSE00000720572.2. This resulted in deletion(s) of 1061 bp (location: Chr7:127373550-127374610; GRCm39), 1263 bp (location: Chr7:127372283-127373545; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Orai3 Mutation: 18 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)