Mtg1^em2(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mtg1^em2(IMPC)Bay
• Name: mitochondrial ribosome-associated GTPase 1; endonuclease-mediated mutation 2, Baylor College of Medicine
• MGI ID: MGI:6257606
• Gene: Mtg1 Location: Chr7:139717477-139730699 bp, + strand Genetic Position: Chr7, 85.16 cM
• Alliance: Mtg1^em2(IMPC)Bay page
• IMPC: Mtg1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA, 2 guide sequences GGCGTTCCTTCCATAGCTCATGG, CCCATGATCGGGATGAGTAATGA, and a non-contributing oligo, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mtg1 Mutation: 20 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)