Slc3a1^{em1(IMPC)Cnrm}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc3a1^{em1(IMPC)Cnrm}
• Name: solute carrier family 3, member 1; endonuclease-mediated mutation 1, Monterotondo
• MGI ID: MGI:6257603
• Gene: Slc3a1 Location: Chr17:85335804-85371664 bp, + strand Genetic Position: Chr17, 55.17 cM
• Alliance: Slc3a1^{em1(IMPC)Cnrm} page
• IMPC: Slc3a1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at CNR Monterotondo by injecting CAS9 RNA, 2 guide sequences GGCTCAGCAACCATTCTCAACAGG, GGACAAGTGGGAAGCCCTTCAGG, and a donor oligo, which resulted in a Conditional Ready allele. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc3a1 Mutation: 34 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)