Slc3a1em1(IMPC)Cnrm
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc3a1em1(IMPC)Cnrm |
| Name: |
solute carrier family 3, member 1; endonuclease-mediated mutation 1, Monterotondo |
| MGI ID: |
MGI:6257603 |
| Gene: |
Slc3a1 Location: Chr17:85335804-85371664 bp, + strand Genetic Position: Chr17, 55.17 cM
|
| Alliance: |
Slc3a1em1(IMPC)Cnrm page
|
| IMPC: |
Slc3a1 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at CNR Monterotondo by injecting CAS9 RNA, 2 guide sequences GGCTCAGCAACCATTCTCAACAGG, GGACAAGTGGGAAGCCCTTCAGG, and a donor oligo, which resulted in a Conditional Ready allele.
(J:265051, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Slc3a1 Mutation: |
34 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|