About   Help   FAQ
Pbld2em3(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Pbld2em3(IMPC)Bay
Name: phenazine biosynthesis-like protein domain containing 2; endonuclease-mediated mutation 3, Baylor College of Medicine
MGI ID: MGI:6257595
Gene: Pbld2  Location: Chr10:62860094-62894592 bp, + strand  Genetic Position: Chr10, 32.52 cM, cytoband B4
Alliance: Pbld2em3(IMPC)Bay page
IMPC: Pbld2 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein, the guide sequence CCAGATGCTTCGCGCCGTGGGTT, and a donor oligo, which resulted in a Point Mutation allele. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pbld2 Mutation:  41 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory