Cdkn1a^{em1(IMPC)Cnrm}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdkn1a^{em1(IMPC)Cnrm}
• Name: cyclin dependent kinase inhibitor 1A; endonuclease-mediated mutation 1, Monterotondo
• MGI ID: MGI:6257562
• Gene: Cdkn1a Location: Chr17:29309953-29319696 bp, + strand Genetic Position: Chr17, 15.12 cM
• Alliance: Cdkn1a^{em1(IMPC)Cnrm} page
• IMPC: Cdkn1a gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: This allele from IMPC was generated at CNR Monterotondo by injecting CAS9 RNA, 2 guide sequences GGTACTTTTGATTGGCCTGATGG, GGTGTTGTGCCCTGTGGCTGTGG, and a donor oligo, which resulted in a Conditional Ready allele. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cdkn1a Mutation: 63 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)