Sspo^em8(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sspo^em8(IMPC)Tcp
• Name: SCO-spondin; endonuclease-mediated mutation 8, The Centre for Phenogenomics
• MGI ID: MGI:6257494
• Gene: Sspo Location: Chr6:48425163-48478184 bp, + strand Genetic Position: Chr6, 23.42 cM
• Alliance: Sspo^em8(IMPC)Tcp page
• IMPC: Sspo gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences GCATGGCCAAACATTTACCC, GCTATGGCAGGGATCCGTGG, TCTAACCTATGTAGGCGTTA, and TTGCGTGAACTCCCTTCTCC that targeted exon(s) ENSMUSE00000298721.4 ENSMUSE00000298728.4. This resulted in deletion(s) of 587 bp (location: Chr6:48442207-48442793; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sspo Mutation: 226 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)