Shld1em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Shld1em1(IMPC)Wtsi |
| Name: |
shieldin complex subunit 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute |
| MGI ID: |
MGI:6257464 |
| Gene: |
Shld1 Location: Chr2:132528871-132592975 bp, + strand Genetic Position: Chr2, 64.74 cM, cytoband F3
|
| Alliance: |
Shld1em1(IMPC)Wtsi page
|
| IMPC: |
Shld1 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences AGTTTCTTTGGAGTCGGACA, ATTGCTTTAGGCCAATCAAT, GCTTCATCATCACTACTAGC, and GGCCTTGGGAGGACGTTGTG that targeted exon(s) ENSMUSE00000346493.3 ENSMUSE00000521637.4 ENSMUSE00001571438.1 ENSMUSE00001571873.1 ENSMUSE00001571874.1 ENSMUSE00002031967.1 ENSMUSE00002031968.1 ENSMUSE00002031969.1 ENSMUSE00002031970.1 ENSMUSE00002031973.1 ENSMUSE00002031977.1 ENSMUSE00002031979.1 ENSMUSE00002031980.1 ENSMUSE00002031981.1 ENSMUSE00002133350.1 ENSMUSE00002133352.1 ENSMUSE00002169426.1 ENSMUSE00002190884.1 ENSMUSE00002190885.1 ENSMUSE00002190886.1 ENSMUSE00002190887.1 ENSMUSE00002190888.1. This resulted in deletion(s) of 64572 bp (location: Chr2:132528689-132593260; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
7 reference(s) |
|