Cdan1^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdan1^{em1(IMPC)Wtsi}
• Name: codanin 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6257455
• Gene: Cdan1 Location: Chr2:120546635-120561998 bp, - strand Genetic Position: Chr2, 60.37 cM
• Alliance: Cdan1^{em1(IMPC)Wtsi} page
• IMPC: Cdan1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 Protein, the guide sequence CCCGAATCTTTAAACTTAAACTA, and a donor oligo, which resulted in a Point Mutation allele. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cdan1 Mutation: 65 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)