About   Help   FAQ
Gins3em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gins3em1(IMPC)Tcp
Name: GINS complex subunit 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6257451
Gene: Gins3  Location: Chr8:96360187-96371687 bp, + strand  Genetic Position: Chr8, 47.12 cM
Alliance: Gins3em1(IMPC)Tcp page
IMPC: Gins3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1152 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCAGTGGAGTCGGGCGCTCT targeting the 5' side and ATGGGCGTCTCGACCCGCAC targeting the 3' side of a critical exon resulting in a 79-bp deletion Chr8: 95633624 to 95633702 (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gins3 Mutation:  7 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory