Ankle2^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankle2^em1(IMPC)Bay
• Name: ankyrin repeat and LEM domain containing 2; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257450
• Gene: Ankle2 Location: Chr5:110378870-110404513 bp, + strand Genetic Position: Chr5, 53.4 cM, cytoband F
• Alliance: Ankle2^em1(IMPC)Bay page
• IMPC: Ankle2 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences ACACATTGGGAACTCCATAT and GTACACTAAATGGCCAGACA that targeted exon(s) ENSMUSE00000298893.2 ENSMUSE00000540519.2 ENSMUSE00001350052.2. This resulted in deletion(s) of 2 bp (location: Chr5:110386235-110386236; GRCm39), 1004 bp (location: Chr5:110385215-110386218; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ankle2 Mutation: 58 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)